snipegaming snipegaming
  • 03-11-2016
  • Mathematics
contestada

what is 1/10 of 0.9 in decimal form

Respuesta :

raymeshcnelle
raymeshcnelle raymeshcnelle
  • 03-11-2016
That is 1/10 of 0.9 in decimal form. 
The 9 is in the tenths place. You can't break it down any further. 
Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
A generator stores electric current. Explain why you agree or disagree with this statement
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
Is 5/7 greater than 4/6
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
why did Mr Collins come to the Bennet family looking for a wife?