mgann804 mgann804
  • 03-01-2020
  • Business
contestada

Search marketing involves placing _____ on the organic results page of search engines.

Respuesta :

ekeneizuka ekeneizuka
  • 04-01-2020

Answer: Advertisements

Explanation:

Search engine marketing is a form of internet marketing, where website owners increase their website's views from search engine results, this can be achieved through paid or unpaid adverts.

The paid adverts may include the use paid Google adverts while the unpaid adverts would include the use of search engine optimization.

Answer Link

Otras preguntas

how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
i need help with #3
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Step by step directions Square root for 480
how would u form a superlative for the adverb widely
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t