unaflynnest200 unaflynnest200

04-06-2018
Mathematics

contestada

write each number in the rational form
a) 0.03
b) 7
show your work

Respuesta :

asadoujohn asadoujohn

09-06-2018

a) 0.03
b) 7

That is the answer because both numbers are already in rational form.

Answer Link

Otras preguntas

Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.

Self-efficacy is ________.our level of confidence in our own abilitiesthe belief that we have power over our livesa state of being in which our thoughts about o

What is the slope of the line that contains the points (10,-3) and (8,-9)?

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?

Studies of populations that reveal correlations between dietary habits and disease incidence are

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.

There are only three types of polygons that can be the faces of a Platonic solid. They are _____, _____, and _____. Check all that apply. A. rectangles B. squar

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,