doubledutch198otlzfu doubledutch198otlzfu

03-08-2017
Arts

contestada

why have more cultures throughout history used artistic works as a form of representation

Respuesta :

pegasistersunit pegasistersunit

03-08-2017

because art is something humans just do. all humans have a liking to music or drawing or sculpting or some kind of art. its not a cultural thing, its a human thing.

Answer Link

Otras preguntas

What is the meaning of astronomy

Which of the following is not a common issue/delay in communication for individuals with ASD? a. An understanding of word boundaries b. Memorizing chunks of la

A 0.881 g sample of a diprotic acid is dissolved in water and titrated with 0.160 M NaOH . What is the molar mass of the acid if 35.8 mL of the NaOH solution is

At a wildlife park, zoey counted 10 lions and 14 tigers. What is the ratio of lions to tigers?

What is true about equinox?

Plastic edging for flower beds comes in 50-foot rolls and costs $6.85 per roll. What is the cost to completely edge two rectangular flower beds 40 feet by 15 fe

A group of high school seniors took a scholastic aptitude test. The resulting math scores had a mean 504.7 with a standard deviation of 191.4, verbal scores had

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Which of these is most likely true about the front located in the area north of Austin? A. It will arrive over Phoenix in the next few days. B. It will bring a

Could use some help : ) Why does the series starting from n = 0 going to infinity of 1/(7n+3) diverge? (see picture below)